Research Article |
Corresponding author: Oliver Gailing ( ogailin@gwdg.de ) Academic editor: Myriam Heuertz
© 2022 Sayed Jalal Moosavi, Katharina Birgit Budde, Markus Mueller, Oliver Gailing.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Moosavi SJ, Budde K, Mueller M, Gailing O (2022) Genetic diversity and fine-scale spatial genetic structure of the near-threatened Pinus gerardiana in Gardiz, Afghanistan. Plant Ecology and Evolution 155(3): 363-378. https://doi.org/10.5091/plecevo.95754
|
Background and aims – Chilgoza pine (Pinus gerardiana) is a near-threatened tree species from the north-western Himalayas. This species is the economically most important pine in Afghanistan because of its edible nuts; however, its distribution range is disjunct and restricted to a few isolated regions. The IUCN lists Chilgoza as a near threatened species because of overexploitation of its nuts and a declining population trend. This research is the first in-depth analysis of the genetic variability and structure of Chilgoza in Afghanistan using microsatellite markers.
Material and methods –We tested cross-amplification of 44 SSR markers developed for pine species. Eight polymorphic EST-SSRs were genotyped in a natural Chilgoza population in Gardiz, Afghanistan. To evaluate the genetic diversity, fine-scale spatial genetic structure (SGS), signatures of bottleneck events, and the effective population size, 191 trees were sampled and genotyped. Based on the diameter at breast height, individuals were classified as young or old trees.
Key results – Genetic variation in the whole population was moderate. For individual markers, He ranged from 0.130 to 0.515 (mean = 0.338) and Ho from 0.118 to 0.542 (mean = 0.328). The expected heterozygosity in young trees was slightly lower than in old trees. The SGS was stronger for young trees (Sp = 0.0100) than for old trees (Sp = 0.0029). Heterozygosity excess analysis detected no recent population size reduction, but the M ratio revealed an ancient and prolonged bottleneck in the Chilgoza population.
Conclusion – Identification of suitable EST-SSRs for future studies of natural Chilgoza populations provides important tools for the conservation of the species. Despite the moderate genetic variation in Gardiz, scarcity of natural regeneration is likely to reduce the genetic variation and adaptability in future generations. Our results indicated a slight decrease in genetic diversity and stronger SGS in young trees calling for conservation measures fostering natural regeneration.
Chilgoza, effective population size, fine-scale spatial genetic structure, genetic diversity, microsatellites, Pinus gerardiana
Tree species are the dominant species in forest ecosystems worldwide, providing essential ecosystem services, such as soil and water conservation, and habitat and resources for associated species (e.g.
Pinus gerardiana Wall. ex D.Don (English: Chilgoza; Persian: Jalghoza, meaning “40 nuts”) is economically and ecologically important in Afghanistan. Nevertheless, it is threatened by overexploitation. Mitigating this threat by conservation and maintaining genetic diversity requires genetic information, which is not yet available. Especially in Afghanistan, the economy and livelihood of the local population living close to these forests depend on the pine nuts trade. Nuts of this tree are edible (Fig.
According to the International Union for Conservation of Nature (IUCN) Red List version 3.1, Chilgoza is considered near threatened due to habitat fragmentation and a decreasing population trend (
Chilgoza pine occurs in dry valleys of eastern Afghanistan, contiguous northern and north-western Pakistan, north-western India, and Tibet and Xizang province of China (
Pinus gerardiana maps. A. Distribution map of Pinus gerardiana, redrawn from
The species is wind-pollinated, and the large, wingless seeds (Fig.
The basic prerequisite for developing suitable strategies to protect genetic resources is the study of genetic variability. Therefore, a primary objective of conservation genetics is to estimate the level and distribution of genetic variation in endangered species to optimize sampling strategies for conserving and managing genetic resources (
Studies of natural genetic variation in P. gerardiana are scarce, and only a few genomic resources are available, e.g. the chloroplast genome published by
Here, we set out to identify suitable EST-SSR markers for P. gerardiana and to characterize the genetic variation in a natural stand in Gardiz, Afghanistan. We specifically compared different age classes of this vulnerable tree species. Due to overexploitation and a lack of natural regeneration, we hypothesized that younger trees might harbour lower levels of genetic diversity than older trees. Given the importance of Chilgoza pines for the local population in Afghanistan and the declining population trend, a better understanding of the genetic structure is crucial.
We collected Chilgoza pine needle samples (Fig.
Characteristics of the four sampled subpopulations in the Pinus gerardiana population close to Gardiz, Afghanistan.
Sub-population | Number of samples | Mean altitude (m) | Geographical coordinate | Mean DBH (cm) | Area (ha) |
Gardiz1 | 50 | 2820.08 | 33°28’49.6”N, 69°23’05.6”E | 29.79 | 1.26 |
Gardiz2 | 49 | 2714.86 | 33°28’40.7”N, 69°23’12.6”E | 33.36 | 1.00 |
Gardiz3 | 50 | 2676.08 | 33°28’30.2”N, 69°23’14.0”E | 31.22 | 1.08 |
Gardiz4 | 42 | 2636.48 | 33°28’33.9”N, 69°23’18.0”E | 29.94 | 1.22 |
Diameter at breast height (DBH at 1.40 m) and GPS (GPSmap 60CSx, Garmin, USA) coordinates of each tree were recorded. In the near absence of natural regeneration, we only sampled trees with a DBH > 6 cm. The largest and smallest DBH were 65.6 cm and 6.36 cm, respectively. In the DBH histogram, the class intervals were adjusted to 5 cm to visualize the DBH distribution in more detail (Supplementary file 1: Fig. S1). We followed the definition by
Needles were stored in individual paper envelopes, and packages of 2 g silica gel (Tamad Kala, Iran) were placed inside the envelopes to dry the needles. After drying the samples in Afghanistan and transferring them to the University of Goettingen, Germany, the DNA of needles was extracted.
Genomic DNA was extracted according to the producer’s protocol for silica gel dried needles with the DNeasy 96 Plant Kit (Qiagen, Germany). DNA quality and quantity were tested in 1.0% agarose gels stained with Roti®Gelstain (Carl ROTH, Germany) and then visualized under UV light and compared to a Lambda DNA size marker (Roche, Germany). Isolated DNA was used directly for PCR amplification without dilution.
Polymerase chain reactions (PCR) were performed with M13 tails (5’-CACGACGTTGTAAAACGAC-3’) and dye labelled adaptors complementary to forward primers (
The PCR mix was composed of 1.0 μL genomic DNA (ca 10 ng/μL), 1.5 μL 10x reaction buffer B (Solis BioDyne, Estonia), 1.5 μL MgCl2 (25 mM), 1.0 μL dNTPs (2.5 mM each dNTP), 0.2 μL (5 U/ μL) HOT FIREPol® Taq DNA polymerase (Solis BioDyne, Estonia), 0.2 μL tailed (
Forty-four SSR primers, including 19 EST-SSRs from P. bungeana (
Characteristics of the polymorphic EST-SSRs used in this study. M, multiplex PCRs; S, separate PCRs; F, 6-FAM fluorescent dye; H,HEX fluorescent dye.
Marker name | Repeat motif | Observed size range (bp) | Sequence (5’-3’) | |
33255 M, F | (AAGGC)5(GAG)5 | 200–220 | F: TCAGCAACCAAACCATACCA | |
R: TGCACTCGCTCCCTATCTTT | ||||
34533 M, F | (CTCACC)6 | 265–277 | F: ATCTCGGCCAATTTGTCATC | |
R: TTGGTCCACCTTTCATCCTC | ||||
66538 M, F | (GGGCGA)4 | 295–301 | F: ATATTGATCAGGCGAGGCAG | |
R: GGATTGTTGCAGGTTTTCGT | ||||
24177 S, H | (GGCTGC)4 | 262–292 | F: CTGGGGAGTATGCACACCTT | |
R: CAGTATCAACAGCAAGCCCA | ||||
7028 S, H | (TTC)8 | 230–251 | F: AGCCATTTCTTCTGCTTCCA | |
R: TTTTCACCCATTCTCCTTCG | ||||
10962 S, F | (TA)11 | 273–277 | F: CGGCCTTTCACTTCTGGTAG | |
R: TGCTGACAAACAAACCGAGA | ||||
3534 S, F | (AT)12 | 283–289 | F: AAGCATCTGCACCTATTGGG | |
R: GTGGAATTGAGATCGGCTGT | ||||
72763 S, H | (AAAACC)4 | 274–282 | F: GGCAATTCTGCAGTAGCCTC | |
R: ATGGTCTGTCCATTTCGGTG |
In order to pool the PCR products from different loci with similar sizes, the PCR reactions were carried out with M13 primers labelled with fluorescent dyes 6-FAM (blue) or HEX (green, see Table
To check for the presence of null alleles, MICRO-CHECKER v.2.2.3 was used (
Genetic population structure was assessed and quantified in two steps. First, a Principal Coordinates Analysis (PCoA) was performed in GenAlEx v.6.5 (
To assess the fine-scale SGS using SPAGeDi 1.5d (
In addition, to test for signals of past demographic changes, the T2 statistic implemented in INEst v.2.2 (
The effective population size (Ne) was estimated using the linkage disequilibrium method (
DBH sizes were 6.36 cm to 65.57 cm (mean 31.19 cm). Few individuals showed very small or very large DBH. Intermediate DBH values were most common (Supplementary file 1: Fig. S1).
Amplification of almost all EST-SSRs (18 of 19 markers) originally developed for P. bungeana was successful (95%). Eight of them were polymorphic (Supplementary file 1: Table S1), showing a high transferability rate of EST-SSR markers from P. bungeana to P. gerardiana.
While high transferability of the markers from different species was observed in Chilgoza pine (Supplementary file 1: Tables S1, S2), SSR markers from more distantly related Pinus species were not polymorphic. All eight cpSSRs from P. thunbergii amplified but were not polymorphic. Four out of five (80% of transferability) tested EST-SSR markers from P. halepensis amplified monomorphic bands. Of the six genomic SSR markers transferred from P. taeda none showed amplification. However, five out of the six EST-SSRs derived from P. taeda amplified but were monomorphic.
Single markers showed a broad range of Fis values (-0.130–0.142). Two markers had negative Fis values (33255 and 66538, Table
Genetic variation over all samples for each locus. N, number of successfully genotyped samples; Na, number of alleles; Nae, effective number of alleles; He, expected heterozygosity; Ho, observed heterozygosity; Fis, inbreeding coefficient; p values of Fis.
Locus | #N | N a | N ae | H e | H o | F is | p value (Fis) |
33255 | 177 | 7 | 1.920 | 0.480 | 0.542 | -0.130 | 0.004 |
34533 | 189 | 3 | 1.240 | 0.190 | 0.175 | 0.085 | 0.230 |
66538 | 191 | 2 | 1.300 | 0.228 | 0.230 | -0.010 | 0.942 |
24177 | 188 | 8 | 2.070 | 0.515 | 0.468 | 0.093 | 0.038 |
7028 | 191 | 8 | 1.890 | 0.472 | 0.466 | 0.013 | 0.780 |
10962 | 184 | 3 | 1.640 | 0.389 | 0.364 | 0.066 | 0.294 |
3534 | 180 | 4 | 1.440 | 0.304 | 0.261 | 0.142 | 0.023 |
72763 | 187 | 3 | 1.150 | 0.130 | 0.118 | 0.096 | 0.232 |
The levels of genetic diversity were very similar between old and young trees (Table
Genetic variation over seven loci without null alleles for young (DBH < 29 cm) and old (DBH > 29 cm) trees in Pinus gerardiana from Gardiz. N, number of samples; Na, number of alleles; Nae, effective number of alleles; AR (k = 28), allelic richness of a standardized sample of 28 gene copies; He, expected heterozygosity; Ho, observed heterozygosity; Fis, inbreeding coefficient; p values of Fis.
Cohort | #N | N a | N ae | A R (k = 28) | H e | H o | F is | p value (Fis) |
Gardiz (young) | 101 | 4.430 | 1.590 | 3.200 | 0.334 | 0.319 | 0.046 | 0.130 |
Gardiz (old) | 90 | 4.430 | 1.620 | 3.170 | 0.354 | 0.358 | -0.011 | 0.719 |
Mean | 4.430 | 1.605 | 3.180 | 0.344 | 0.338 |
A total of 38 alleles were observed across 191 individuals. Based on the Kruskal-Wallis test, observed and expected heterozygosity differences among the four subpopulations and two age cohorts were not significant. Correlation analyses did not reveal a significant association between individual heterozygosity and DBH in the four subpopulations (Supplementary file 1: Fig. S2) and also not for elevation and DBH (data not shown).
PCoA (Principal Coordinates Analysis) based on Nei’s unbiased genetic distance did not show a clustering by subpopulation or DBH class, indicating no genetic structure (Supplementary file 1: Fig. S3). Likewise, the STRUCTURE analysis did not identify any genetic clusters (Supplementary file 1: Fig. S4). The highest probability of our data was observed for K = 1 (Supplementary file 1: Figs S5, S6).
The fine-scale SGS indicated a significant family structure for young trees (Sp = 0.0100, p = 0.0003) and no significant family structure for the old trees (Table
Characterization of the fine-scale spatial genetic structure using eight microsatellite markers in Pinus gerardiana in Gardiz, Afghanistan for young and old trees. F1, multilocus kinship coefficient between individuals of the first distance class (
Cohort | F1 | bf | Sp | p value (bf) | eig.sPCA | p value (G-test) |
Gardiz (young) | 0.0847 | -0.0092 | 0.0100 | 0.0003 | 0.0905 | 0.0010 |
Gardiz (old) | 0.0619 | -0.0027 | 0.0029 | 0.2011 | 0.0632 | 0.0300 |
A significant heterozygosity excess in populations is interpreted as a recent bottleneck. However, under TPM and also under IAM, negative T2 values indicated no signs of a recent reduction in population size in young and old cohorts. Wilcoxon signed-rank test under TPM and IAM for heterozygosity excess rather pointed to a deficiency in heterozygosity (Table
The effective population size (when allowing for 0.02 as the lowest allele frequency) was estimated to be slightly lower for the old cohort (Ne_LD_0.02 = 101.3, 95% CI = 47.2–553.8) than for the younger cohort (Ne_LD_0.02 = 401.1, 95% CI = 101.8–infinite) but the confidence intervals largely overlapped.
Genetic bottleneck tests in Pinus gerardiana cohorts in Gardiz under the Two-Phase (TPM) and the Infinite-Allele Model (IAM) using the Wilcoxon signed-rank test, as well as the M ratio approach. The T2 statistic (combined Z-score in INEst) and M ratio (observed MR and MReq in an equilibrium population averaged over loci) are reported, and the p values are based on 106 permutations.
Cohort | T2 under TPM | T2 under IAM | M-ratio | ||||
T2 | p value | T2 | p value | MR | MReq | p value | |
Gardiz (young) | -3.5375 | 0.9844 | -0.9428 | 0.9448 | 0.6017 | 0.8875 | 0.0079 |
Gardiz (old) | -3.5998 | 0.8906 | -0.5240 | 0.7115 | 0.7065 | 0.8942 | 0.0253 |
The de novo development of SSRs is a time and cost-consuming procedure, especially for non-model species for which genomic resources are scarce. Most SSR primers are species-specific; hence, they cannot be transferred to other species. However, EST-SSRs are the best choice for obtaining high-quality gene-based nuclear microsatellite markers for non-model species because of their high transferability across closely related species (
Transferability of markers reflected the relatedness among the taxa. EST-SSRs from P. bungeana were transferrable (95%) and polymorphic (47%), reflecting the close systematic relationship between Chilgoza pine and P. bungeana, belonging to section Quinquefoliae and subsection Gerardianae. Pinus thunbergii and P. halepensis belong to the section Pinus but different subsections (Pinus and Pinaster, respectively). Nevertheless, almost all the markers derived from them amplified but were monomorphic in P. gerardiana. Since the chloroplast genome is more conserved than the nuclear genome (
Higher heterozygosity in the P. gerardiana population in Gardiz compared to P. bungeana using partly the same EST-SSRs was detected.
PCoA and STRUCTURE analysis across the individuals revealed no significant structure or clustering among subpopulations for young or old tree cohorts. This is in line with our expectations as no population structure at this small spatial scale was expected for a wind-pollinated and bird-dispersed tree species. The large spotted nutcracker most likely disperses the seeds of Chilgoza pine, and large dispersal distances are expected. We found a moderate fine-scale SGS in the young trees (Sp = 0.0100) but no significant family structure in the older trees. In agreement with this, the sPCA indicated a significant global structure in both cohorts but with a slightly stronger family structure in young trees than in old trees. Usually, a weak, or non-significant fine-scale SGS is common in Pinus species (
When comparing different age cohorts, previous studies have found no congruent difference in the fine-scale SGS.
Overexploitation may also have significantly reduced the nuts available to the large spotted nutcracker. This reduction in food may have reduced the population of the birds or forced them to migrate or even go extinct in the region. Over the past decades, a decline of this main seed dispersal agent could also have led to an increase in SGS. Data about the abundance, ecology, and behaviour of the large spotted nutcracker in this region would be very valuable. Additionally, stronger SGS could increase homozygosity (
Climate oscillations have changed the distribution ranges and population sizes of species in the past, including forest trees. Many temperate tree species shifted towards the lower latitudes, resulting in a sometimes severe range reduction (
While we did not find signs of a recent bottleneck, we observed fewer trees in smaller size classes, indicating that natural regeneration is not as abundant as some decades ago. Typically, the smaller size classes should be the most abundant ones (
Estimating effective population size, Ne, and monitoring its changes over time is crucial in assessing the risk of extinction for endangered species (
The total forest cover of Afghanistan was strongly reduced compared to its original state as a result of longtime instability during the last few decades (
In this research, we collected 191 samples from Chilgoza pines in Paktia province, one of the most insecure locations in Afghanistan (
Younger trees are mostly missing which could possibly result in a strong population size decline in the long term. However, despite signatures of an ancient bottleneck, the Chilgoza stands currently contain moderate genetic variation and an effective population size similar to that of other pine species. Furthermore, the environmental conditions, such as well-drained and sandy soils in eastern Afghanistan, are favourable for Chilgoza pines, making them superior and dominant compared to other tree species (
The sustainable management of forests requires a better understanding of the specific features of forest trees and their genetic diversity. Therefore, provenance trials should be established in Paktia, Paktika, and Khost provinces which produce 86% of Afghanistan’s Chilgoza pine nuts (
EST-SSR data, GPS coordinates, and diameter at breast height measures were deposited in the Göttingen Research Online repository (https://doi.org/10.25625/MGKPZA).
We thank the German Academic Exchange Service (DAAD) for its financial support of Sayed Jalal Moosavi. We would like to thank Christine Radler and Alexandra Dolynska for their technical support in the laboratory, Dr Sayed Isamel Moosavi, Zahra Moosavi, and Somayah Moosavi for their support and help with sampling in Gardiz.
DBH histogram of all P. gerardiana samples (Fig. S1); list of EST-SSRs, genomic SSRs, and chloroplast SSRs (Table S1); transferability information of genetic markers from related pine species to P. gerardiana (Table S2); genetic variation over seven loci for each subpopulation and DBH class (Table S3); genetic variation over eight loci for each marker in the old and young cohorts (Tables S4, S5); scatterplot of 191 individuals heterozygosity plotted against the DBH (Fig. S2); PCoA based on genetic distances (Fig. S3); structure plots of all samples (Fig. S4); the plot of mean likelihood L(K) and variance per K value from STRUCTURE (Fig. S5); the plot of delta K (Fig. S6); sPCA plots for young (Fig. S7) and old cohort (Fig. S8).