118 urn:lsid:arphahub.com:pub:71cc5dc6-a767-5334-951f-ef6ae8936459 Plant Ecology and Evolution plecevo 2032-3913 2032-3921 Meise Botanic Garden and Royal Botanical Society of Belgium 10.5091/plecevo.153974 153974 Research Article Basal Angiosperms: Monocots Poaceae Poales Genomics Molecular genetics Molecular systematics Taxonomy Asia China China Seas Far East Genome origin and phylogenetic relationships of Campeiostachys (Triticeae: Poaceae) based on nuclear and chloroplast DNA regions Tan Lu tanlu19910222@163.com https://orcid.org/0000-0002-4235-5382 1 2 Writing - original draft Data curation Software Hu Meng 2 Data curation Wu Dan-Dan 2 Funding acquisition Software Cheng Yi-Ran 2 Formal analysis Sha Li-Na 2 Resources Fan Xing 2 Resources Kang Hou-Yang 2 Project administration Wang Yi 2 Data curation Valdés-Florido Ana https://orcid.org/0000-0002-0325-0414 3 4 Writing - review and editing Zhang Hai-Qin 2 Conceptualization Methodology Zhou Yong-Hong 2 Conceptualization Supervision Panxi Crop Improvement Key Laboratory of Sichuan Province, Xichang University, Xichang, Sichuan, China Triticeae Research Institute, Sichuan Agricultural University, Wenjiang, Chengdu, Sichuan, China College of Grassland Science and Technology, Sichuan Agricultural University, Chengdu, Sichuan, China State Key Laboratory of Crop Genetic Exploration and Utilization in Southwest China, Sichuan Agricultural University, Wenjiang, Chengdu, Sichuan, China Department of Plant Biology and Ecology, Faculty of Biology, University of Seville, Seville, Spain Department of Molecular Biology and Biochemical Engineering, Universidad Pablo de Olavide, Seville, Spain

Corresponding author: Lu Tan (tanlu19910222@163.com)

Academic editor: Brecht Verstraete

 2025 12 09 2025 158 3 337 349 B4C62D0B-16F2-5501-B42C-3A0733585DBE 26 03 2025 22 07 2025 Lu Tan, Meng Hu, Dan-Dan Wu, Yi-Ran Cheng, Li-Na Sha, Xing Fan, Hou-Yang Kang, Yi Wang, Ana Valdés-Florido, Hai-Qin Zhang, Yong-Hong Zhou This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Background and aims – Campeiostachys is an allohexaploid perennial genus of the Triticeae tribe (Poaceae). The allopolyploids of Triticeae are produced by interspecific hybridization of different genera. In this study, we investigate the genome origin of Campeiostachys and the relationships of some species based on phylogenetic analyses.

Material and methods – Two nuclear (Acc1 and DMC1) and two chloroplast (matK and rps16) DNA regions of the species of Campeiostachys and its related genera were used for phylogenetic analyses.

Key results – The Acc1 and DMC1 sequences revealed that the genome composition of all Campeiostachys species in our study is StYH, suggesting that Campeiostachys may have originated by the natural hybridization between species with StY and H genomes, as no species with Y or HY genomes have been found in the wild. The results from the chloroplast regions indicated that the maternal donor of the Campeiostachys species contains the St subgenome. In addition, phylogenetic analysis of the nuclear sequences showed that C. purpuraristata always groups with the species of the C. dahurica complex in the St, Y, or H clade, distinct from other species in the genus. Also, C. calcicola, C. kamoji, and C. tsukushiensis var. transiens are distinct yet closely related species.

Conclusion – Campeiostachys species originated from the natural hybridization of the tetraploid species of Roegneria (StY) with the diploid species of Hordeum (H), with Roegneria (StY) acting as the maternal donor. Campeiostachys purpuraristata should be classified into the C. dahurica complex and treated as C. dahurica var. purpuraristata.

 allohexaploid Campeiostachys genome constitution maternal donor natural hybridization phylogeny National Natural Science Foundation of China 501100001809 https://ror.org/01h0zpd94 http://doi.org/10.13039/501100001809 Science and Technology Bureau of Sichuan Province Introduction

Hybridization and polyploidization play a key role in plant evolution and speciation (Stebbins 1950; Soltis and Soltis 2000; Otto and Whitton 2000). Polyploids formed by intraspecific genome replication or hybridization of different genotypes are autopolyploids, while those formed by interspecific hybridization are allopolyploids (Stebbins 1947; Grant 1981; Liu et al. 2006; Brassac and Blattner 2015). The tribe Triticeae, an important gene pool for the genetic improvement of wheat, barley, and other Triticeae crops (Dewey 1984; Lu 1993), includes many polyploid taxa (Yen et al. 2005; Baum et al. 2011). Among these, the allopolyploids of Triticeae are produced by intergeneric hybridization of the genera with different genome composition (Sears 1954; Kimber and Alonso 1981; Dewey 1984; Heslop-Harrison 1992; Petersen et al. 2011). Based on the genomic system of classification in Triticeae, the species with the same genome or genome combinations were classified into one genus (Löve 1984; Yen et al. 2005; Baum et al. 2011; Lucía et al. 2019). Thus, these allopolyploid species are classified into different polyploid genera based on their genome composition (Cai 1997; Yen et al. 2005; Barkworth et al. 2009; Baum et al. 2011; Yen and Yang 2013; Lucía et al. 2019).

The genus Campeiostachys Drobow was established by Drobow (1941), and currently holds 15 species and 13 varieties (Baum et al. 2011; Yen and Yang 2013; Yang et al. 2015, 2016; Tan et al. 2024). Cytogenetic analyses have revealed that all Campeiostachys species are hexaploid and contain three subgenomes (St, Y, and H) (Baum et al. 2011; Yen and Yang 2013). The St and H subgenomes are supposed to have been donated by the diploid Pseudoroegneria (Nevski) Á.Löve and by Hordeum L., respectively (Mason-Gamer 2004; Sun et al. 2008; Sha et al. 2017; Tang et al. 2017). However, the origin of the Y subgenome remains unknown (Jensen 1990; Kellogg et al. 1996; Adderley and Sun 2014). As an allopolyploid genus, Campeiostachys originated from natural hybridization between related genera in the Triticeae, but its parents cannot be identified (Baum et al. 2011; Petersen et al. 2011; Lei et al. 2022).

The relationship between some species within Campeiostachys remains unclear. For example, the taxa included in the Campeiostachys dahurica (Turcz. ex Griseb.) B.R.Baum, J.L.Yang & C.Yen (= Elymus dahuricus Turcz. ex Griseb.) complex have been debated. Because the morphological difference is small, Lu (1993) included Elymus dahuricus, E. excelsus Turcz. ex Griseb, E. tangutorum (Nevski) Hand.-Mazz., Elymus dahuricus var. cylindricus Franch., E. purpuraristatus C.P.Wang & X.L.Yang, and E. villifer C.P.Wang & X.L.Yang in the E. dahuricus complex. In the Flora of China, E. purpuraristatus is treated as an independent species (Chen and Zhu 2006). Combined morphological data and genome composition determined that E. excelsus, E. tangutorum, and E. dahuricus var. cylindricus were to be classified into the genus Campeiostachys, and included in the C. dahurica complex as varieties (Baum et al. 2011; Yen and Yang 2013). Genome in situ hybridization (GISH) results showed that the genome composition of E. purpuraristatus is StYH and the species should be classified into Campeiostachys (Tan et al. 2021). At present, the relationship between C. purpuraristata (C.P.Wang & X.L.Yang) Y.H.Zhou, H.Q.Zhang & Wei Huan Chen and the C. dahurica complex is unclear. Based on morphological and molecular data, the relationship between Campeiostachys kamoji (Ohwi) B.R.Baum, J.L.Yang & C.Yen, Campeiostachys tsukushiensis var. transiens (Hack.) C.Yen & J.L.Yang, and C. calcicola (Keng) Y.H.Zhou, H.Q.Zhang & M.Q.Deng is also uncertain (Kuo 1987; Lu et al. 1990; Yen and Yang 2013).

Phylogenetic analyses have been proven as a fast and effective way for identifying genome composition, species relationships, and progenitor species of allopolyploid taxa, revealing the origin and evolutionary history of polyploid plants (Fortune et al. 2007; Blattner 2009; Fan et al. 2013; Bieniek et al. 2015; Baum et al. 2015). When the DNA sequences of diploid donors and allopolyploids in Triticeae correspond, this allows for the determination of the genome composition of the allopolyploid (Petersen et al. 2006; Wang et al. 2019). Single-copy nuclear genes are biparentally inherited and less susceptible to concerted evolution, making them ideal markers for identifying parental donors and evolutionary relationships of polyploid taxa (Soltis et al. 2004; McMillan and Sun 2004; Rauscher et al. 2004; Liu et al. 2006). In contrast, chloroplast markers are maternally inherited (Hodge et al. 2010; Middleton et al. 2014; Sha et al. 2017), and these sequences have therefore been widely used to identify the maternal donor of allopolyploid species or genera in Triticeae (Dong et al. 2015; Lei et al. 2018).

In this context, the objectives of this study on 15 Campeiostachys polyploids and the diploid and polyploids of related genera are: (1) to elucidate the genome origin of Campeiostachys; (2) to investigate the maternal donor of Campeiostachys species; (3) to explore the phylogenetic relationships among Campeiostachys species.

 Material and methods Plant material

Most of the material was collected by the authors’ research team, except for material of Campeiostachys drobovii (Nevski) B.R.Baum, J.L.Yang, & C.Yen (PI 314203), C. tsukushiensis var. transiens (PI 276396), and Bromus inermis Leyss. (PI 618974), which was kindly provided by the USDA National Plant Germplasm System (https://www.ars-grin.gov). Specimens of the material listed in Table 1 are kept at the Herbarium of Triticeae Research Institute of Sichuan Agricultural University, China (SAUTI).

The materials used for sequencing in this study.

Species Genome Accession No. Origin
Campeiostachys aristiglumis StYH Y 0614 Xinjiang
Campeiostachys calcicola StYH ZY 1005 Sichuan
Campeiostachys drobovii StYH PI 314203 Russian
Campeiostachys dahurica StYH ZY 11033 Inner Mongolia
Campeiostachys dahurica var. cylindrica StYH Y 0750 Xinjiang
Campeiostachys dahurica var. excelsis StYH ZY 11034 Inner Mongolia
Campeiostachys dahurica var. tangutorum StYH Y 2092 Sichuan
Campeiostachys kamoji StYH ZY 1007 Sichuan
Campeiostachys nutans StYH Y 2235 -
Campeiostachys purpuraristata StYH ZY 11075 Inner Mongolia
Campeiostachys schrenkiana StYH Y 2426 -
Campeiostachys tsukushiensis var. transiens StYH PI 276396 Sweden
Elymus atratus StYH ZY 15005 Sichuan
Elymus breviaristatus StYH ZY 17008 Sichuan
Elymus sinosubmuticus StYH ZY 17004 Sichuan
Hordeum bogdanii H ZY 11066 Inner Mongolia
Bromus inermis subsp. inermis - PI 618974 Xinjiang

In addition to the material mentioned in Table 1, we also downloaded the Acc1, DMC1, matK, and rps16 sequences of closely related species (Roegneria K.Koch StY, Elymus L. StH, Stenostachys Turcz. HW, CampeiostachysStYH, Kengyilia C.Yen & J.L.Yang StYP, Anthosachne Steud. StYW, Pascopyrum Á.Löve StYHW, Connorochloa Barkworth, S.W.L.Jacobs & H.Q.Zhang StHNsXm, and some diploid species of the Triticeae) from GenBank. Detailed information is provided in Suppl. materials 1–3.

 DNA amplification and sequencing

The total genomic DNA was extracted from fresh leaves using the CTAB method (Doyle and Doyle 1990). The Acc1, DMC1, matK, and rps16 sequences were amplified with primers and PCR cycles shown in Table 2. Clone using pClone007 Versatile Simple Vector Kit (TSINGKE Biological Technology, Beijing, China), and 20-30 independent clones were randomly selected for sequencing by Sangon Biological Engineering and Technology Service Ltd. (Shanghai, China).

Primers and PCR profiles used in this study.

Gene Primer Sequence of primer (5’-3’) PCR profiles
Acc1 F CCCAATATTTATCATGAGACTTGCA 1 cycle: 5 min 95°C; 35 cycles: 30 s 95°C, 30 s 56°C, 2 min 30 s 68°C; 1 cycle: 10 min 68°C
R CAACATTTGAATGAAThCTCCACG
DMC1 F TGCCAATTGCTGAGAGATTTG 1 cycle: 4 min 95°C; 35 cycles: 1 min 95°C, 1 min 52°C, 1 min 72°C; 1 cycle: 10 min 72°C
R AGCCACCTGTTGTAATCTGG
matK F CGATCTATTCATTCAATATTTC 1 cycle: 4 min 95°C; 35 cycles: 1 min 95°C, 1 min 50°C, 1 min 30 s 72°C; 1 cycle: 10 min 72°C
R TCTAGCACACGAAAGTCGAAGT
rps16 F AAACGATGTGGTAGAAAGCAAC 1 cycle: 4 min 95°C; 35 cycles: 1 min 95°C, 1 min 53°C, 1 min 72°C; 1 cycle: 10 min 72°C
R AAACGATGTGGTAGAAAGCAAC
Phylogenetic analyses

DNA sequences were confirmed through BLAST (Boratyn et al. 2012) on the NCBI database. The sequences were aligned using MAFFT v.7.313 (Katoh et al. 2002), and jModelTest v.3.0 (Posada and Crandall 1998) was used to determine the best-fit DNA substitution models and gamma rate heterogeneity for subsequent analyses. Phylogenetic analyses for each marker alone were conducted using the maximum-likelihood (ML) method in PhyML 3.0 (Guindon et al. 2009) and Bayesian inference (BI) in MrBayes v.3.1.2 (Huelsenbeck and Ronquist 2001). Bromus inermis was used as the outgroup. Statistical support for the nodes in the ML analysis was estimated by using 1000 fast bootstrap replicates. For the combined dataset (Acc1 + DMC1 and rps16 + matK), tandem sequences were processed using PhyloSuite v.1.2.2 (Zhang et al. 2020), and ML and BI were performed using raxmlGui v.2.0 (Edler et al. 2021) and MrBayes v.3.1.2, respectively.

 Results Phylogenetic analyses based on nuclear markers <italic>Acc1 sequences</italic>

The length of the Acc1 sequences of the Campeiostachys species ranges from 1423 to 1448 bp. The data matrix contains 1827 characters, of which 288 are parsimony uninformative and 134 are parsimony informative. The Acc1 data matrix of 88 sequences was analysed with ML using the TIM1+I+G model (-Ln likelihood = 8078.0741). The assumed nucleotide frequencies were A = 0.2546, C = 0.1827, G = 0.2161, T = 0.3467. The tree topology generated by the BI analysis is similar to that inferred by the ML analysis. The ML tree with bootstrap support values (BS, above the branches) and Bayesian posterior probability (PP, below the branches) is displayed in Fig. 1.

10.5091/plecevo.153974.figure1 F859CA68-2FCA-5A9F-8035-49375FB2EA22

Maximum likelihood tree derived from Acc1 sequences of Campeiostachys and related species. The capital letters in brackets after the species name indicate the genome composition of the species. The numbers above and below the branches indicate bootstrap values > 50% and Bayesian posterior probability values > 0.90, respectively.

https://binary.pensoft.net/fig/1412077

All Campeiostachys species have three copies of the Acc1 sequence, which are grouped in the St, Y, and H clades (Fig. 1). The St clade (BS = 93%, PP = 1.00) comprises the diploid species of Pseudoroegneria (St genome donor), the tetraploid species of Elymus (StH), the tetraploid species of Roegneria (StY), and Campeiostachys species (StYH). Within this clade, Campeiostachys tsukushiensis var. transiens, C. kamoji, and C. calcicola cluster together (BS = 82%, PP = 0.99). In addition, Campeiostachys dahurica, C. dahurica var. cylindrica (Franch.) B.R.Baum, J.L.Yang & C.Yen, C. dahurica var. tangutorum (Nevski) B.R.Baum, J.L.Yang & C.Yen, and C. purpuraristata form a group (BS = 50%, PP = 0.92). The Y clade (BS = 90%, PP = 1.00) includes the species of Dasypyrum (Coss. & Durieu) Maire (V), Peridictyon Seberg, Fred. & Baden (Xp), Roegneria (StY), and Campeiostachys (StYH). Within this clade, species of Campeiostachys group with Roegneria grandis Keng and R. pendulina Nevski (BS = 94%, PP = 1.00); and C. kamoji, C. calcicola, and C. tsukushiensis var. transiens cluster in a subclade (BS = 98%, PP = 1.00). Furthermore, C. dahurica, C. dahurica var. tangutorum, C. dahurica var. excelsis (Turcz. ex Griseb.) B.R.Baum, J.L.Yang & C.Yen, C. dahurica var. cylindrica, and C. purpuraristata form a paraphyletic clade (BS = 62%, PP = 0.92). Finally, the H clade (BS = 100%, PP = 1.00) contains Hordeum species (H genome donor), Elymus species (StH), and Campeiostachys species (StYH). Among them, C. dahurica, C. dahurica var. cylindrica, C. dahurica var. excelsis, and C. purpuraristata group together (BS = 86%, PP = 1.00), while C. kamoji, C. calcicola, C. tsukushiensis var. transiens, and C. drobovii group together (BS = 99%, PP = 1.00).

 <italic>DMC1 sequences</italic>

The length of the DMC1 sequences of the Campeiostachys species ranges from 1013 to 1087 bp. The data matrix contains 1266 characters, of which 249 are parsimony uninformative and 103 are parsimony informative. The DMC1 data matrix was analysed with ML using the TIM3+G model (-Ln likelihood = 5162.2108). The assumed nucleotide frequencies were A = 0.3219, C = 0.2140, G = 0.2088, T = 0.2553. The phylogenetic analysis of 103 DMC1 sequences was performed using Bromus inermis as the outgroup (Fig. 2). The tree topology generated by the BI analysis is similar to that inferred by the ML analysis.

10.5091/plecevo.153974.figure2 66678A23-4C56-56D4-9775-6DB4C73E0F74

Maximum likelihood tree derived from DMC1 sequences of Campeiostachys and related species. The capital letters in brackets after the species name indicate the genome composition of the species. The numbers above and below the branches indicate bootstrap values > 50% and Bayesian posterior probability values > 0.90, respectively.

https://binary.pensoft.net/fig/1412078

Three DMC1 sequence copies of the Campeiostachys species are divided into three well-supported clades, which are named the St, Y, and H clades (Fig. 2). In the St clade (BS = 99%, PP = 1.00), Campeiostachys species are grouped with Pseudoroegneria species (St), Roegneria species (StY), and Elymus species (StH). Within this clade, C. kamoji, C. calcicola, and C. tsukushiensis var. transiens are grouped (BS = 69%, PP = 0.96). In addition, C. purpuraristata is closely associated with Pseudoroegneria spicata (Pursh) Á.Löve, Roegneria semicostata (Steud.) Kitag., and C. dahurica var. tangutorum. Also, Campeiostachys dahurica, C. dahurica var. cylindrica, and C. dahurica var. excelsis are closely related. However, none of them fall into a distinct clade. The Y clade (BS = 93%, PP = 1.00) only includes the species of Roegneria (StY) and Campeiostachys (StYH). Of which, C. dahurica groups with C. dahurica var. cylindrica, C. dahurica var. excelsis, C. dahurica var. tangutorum, C. purpuraristata, Roegneria anthosachnoides Keng, and R. gmelinii (Griseb.) Kitag. (BS = 51%, PP = 0.90). Campeiostachys kamoji, C. calcicola, and C. tsukushiensis var. transiens cluster into a subclade (BS = 62%, PP = 0.98). Finally, the H clade (BS = 100%, PP = 1.00) includes the species of Hordeum (H), Elymus (StH), and Campeiostachys (StYH). Among them, C. kamoji, C. calcicola, and C. tsukushiensis var. transiens are grouped with Hordeum brachyantherum Nevski (BS = 61%, PP = 0.97).

 <italic>Acc1+DMC1 sequences</italic>

The phylogenetic tree constructed by combining Acc1 and DMC1 sequences is consistent with the one constructed by the single regions. All Campeiostachys species are divided into three clades (Fig. 3). In the St clade, Campeiostachys species cluster with the species of Pseudoroegneria, Roegneria, and Elymus with strong support (BS = 100%, PP = 1.00). Among them, C. kamoji, C. calcicola, and C. tsukushiensis var. transiens are clustered together (BS = 90%, PP = 1.00). Campeiostachys dahurica, C. dahurica var. cylindrica, C. dahurica var. excelsis, C. dahurica var. tangutorum, and C. purpuraristata form a group (BS = 54%, PP = 0.94). The Y clade (BS = 92%, PP = 0.99) includes not only the species of Roegneria and Campeiostachys but also the Dasypyrum species (V) and Peridictyon species (Xp).

10.5091/plecevo.153974.figure3 D62A07E5-ED41-5C7B-8F02-2951D6B17698

Maximum likelihood tree derived from Acc1+DMC1 sequences of Campeiostachys and related species. The capital letters in brackets after the species name indicate the genome composition of the species. The numbers above and below the branches indicate bootstrap values > 50% and Bayesian posterior probability values > 0.90, respectively.

https://binary.pensoft.net/fig/1412079

In the Y clade, the Campeiostachys species are clustered together (BS = 93%, PP = 1.00). Of which, C. dahurica, C. dahurica var. cylindrica, C. dahurica var. excelsis, C. dahurica var. tangutorum, C. purpuraristata cluster together (BS = 80%, PP = 0.99). Besides, C. kamoji, C. calcicola, and C. tsukushiensis var. transiens cluster into one group (BS = 99%, PP = 1.00). The H clade (BS = 100%, PP = 1.00) includes the species of Hordeum (H), Elymus (StH), and Campeiostachys (StYH). Among them, C. kamoji, C. calcicola, and C. tsukushiensis var. transiens are grouped together (BS = 100%, PP = 1.00). Besides, C. dahurica, C. dahurica var. cylindrica, C. dahurica var. excelsis, and C. purpuraristata cluster together (BS = 94%, PP = 1.00).

 Phylogenetic analyses based on chloroplast markers <italic>matK sequences</italic>

The matK matrix contains 60 taxa and 844 characters, including 99 variable information loci and 38 parsimony informative loci. The phylogenetic analysis was based on maximum likelihood (ML) using GTR+I+G as the best-fit model (-Ln likelihood = 2142.3028). The assumed nucleotide frequencies were A = 0.3094, C = 0.1808, G = 0.1523, T = 0.3575. Both ML and BI trees show the matK sequences of Campeiostachys species divided into the St+V+E clade (BS = 51%) (Fig. 4A). This clade not only includes the diploid species of Pseudoroegneria (St), Lophopyrum Á.Löve (Ee), Thinopyrum Á.Löve (Eb), and Dasypyrum (V), but also the polyploid species of Elymus (StH), Roegneria (StY), Campeiostachys (StYH), Kengyilia (StYP), Pascopyrum (StHNsXm), and Connorochloa (StYHW). Within this clade, C. calcicola, C. tsukushiensis var. transiens, and C. kamoji are grouped together (BS = 63%, PP = 0.97). All species of Campeiostachys are clustered in the St+V+E clade instead of the H clade.

10.5091/plecevo.153974.figure4 2489CA7E-8E6F-59BE-9696-FB4284849EF7

Maximum likelihood tree derived from chloroplast regions of Campeiostachys and related species. A. matK. B. rps16. C. matK+rps16. The capital letters in brackets after the species name indicate the genome composition of the species. The numbers above and below the branches indicate bootstrap values > 50% and Bayesian posterior probability values > 0.90, respectively.

https://binary.pensoft.net/fig/1412080 <italic>rps16 sequences</italic>

A total of 53 rps16 sequences were used for ML analysis. The rps16 sequences matrix contains 706 characters, of which 47 informative loci and 22 parsimony informative loci. The phylogenetic analysis based on the rps16 sequences was conducted using TIM1+G, which was identified as the best-fit model (-Ln likelihood = 1688.6674). The assumed nucleotide frequencies were A = 0.2991, C = 0.1925, G = 0.1478, T = 0.3606. In addition to Campeiostachys species, the St+V+E clade (BS = 50%) also included the diploid species of Pseudoroegneria (St), Lophopyrum (Ee), Thinopyrum (Eb), and Dasypyrum (V) (Fig. 4B). In addition, polyploid species which contain the St subgenome also cluster in this clade, including the species of Elymus (StH), Roegneria (StY), Kengyilia (StYP), Pascopyrum (StHNsXm), and Connorochloa (StYHW).

 <italic>matK + rps16 sequences</italic>

The BI tree and ML tree based on concatenated gene sequences exhibit highly similar topologies. All Campeiostachys species cluster in the same clade, named the St+V+E clade (BS = 58%, PP = 0.91) (Fig. 4C). This subclade also includes the species of Pseudoroegneria (St), Lophopyrum (Ee), Thinopyrum (Eb), Dasypyrum (V), Elymus (StH), Roegneria (StY), Kengyilia (StYP), Pascopyrum (StHNsXm), and Connorochloa (StYHW). Among them, C. calcicola, C. tsukushiensis var. transiens, and C. kamoji cluster together (BS = 67%, PP = 0.90). Hordeum species and Stenostachys narduroides Turcz. (HW) cluster together in a single subclade (BS = 100%, PP = 1.00).

 Discussion The origin of the genus <italic><tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part></tp:taxon-name></italic>

Traditionally, the species in Triticeae with the same genome or genome combination have been classified into the same genus (Löve 1982; Yen et al. 2005; Zhang and Zhou 2007; Baum et al. 2011; Yen and Yang 2011). The correspondence between the DNA sequences of diploid donors and allopolyploids in Triticeae allows the determination of the genome composition of these species through phylogenetic analyses (Petersen et al. 2006; Sun and Komatsuda 2010; Gao et al. 2014; Lei et al. 2022). Cytologically, the genome composition of Pseudoroegneria species is St, Hordeum species is H, Elymus species is StH, Roegneria species is StY, and Campeiostachys species is StYH (Dewey 1984; Yen et al. 2005; Wang et al. 2019). In the present study, the sequences from Campeiostachys species with separated into three distinct clades. The one-copy sequence from each Pseudoroegneria species (St), Elymus species (StH), Roegneria species (StY), and Campeiostachys species (StYH) formed a group. Therefore, this clade was named the St clade using the genomic symbol of the diploid species. One copy sequence from each Hordeum species (H), Elymus species (StH), and Campeiostachys species grouped into one clade, named the H clade using the genomic symbol of the diploid species. The remaining copy sequence from each Campeiostachys species grouped with the other copy sequences from Roegneria species (StY). This indicates that the remaining copy of the Acc1 and DMC1 sequence from these species should have been amplified from the Y genome. Therefore, this clade was named the Y clade. The results of the phylogenetic analyses based on Acc1 and DMC1 revealed that the Roegneria species contain St and Y copies, Elymus species contain St and H copies, and all Campeiostachys species contain St, Y, and H copies (Fig. 1). This indicates distinct genome compositions among these three genera, despite their indistinguishable morphological characteristics. Besides, the diverse genome compositions of Roegneria, Elymus, and Campeiostachys suggest different evolutionary origins.

Allopolyploids in Triticeae arise by interspecific hybridization involving different genera with different genome compositions (Sears 1954; Kimber and Alonso 1981; Dewey 1984; Heslop-Harrison 1992; Petersen et al. 2011; Yen and Yang 2011). Based on its genome composition, the possible origins of Campeiostachys are as follows: St × HY, Y × StH, or H × StY. Genera known to possess the Y genome within Triticaeae include Roegneria (StY), Campeiostachys (StYH), Kengyilia (StYP), Anthosachne (StYW), and Connorochloa (StYWH), with no species containing Y or HY genomes found in the wild (Yen and Yang 1990; Torabinejad and Mueller 1993; Barkworth et al. 2009; Baum et al. 2011; Yen and Yang 2011, 2013; Gao et al. 2014). The phylogenetic analyses based on trnL-F, ndhF, and trnH-psbA chloroplast markers all indicated that the Campeiostachys species are more closely related to the Roegneria species (StY) than to Elymus (StH) (Liu et al. 2006; Lei et al. 2018). The analysis results of genome resequencing revealed that Hordeum roshevitzii Bowden (H) exhibits the highest homology with the H subgenome of E. nutans Griseb. (StYH) (= Campeiostachys nutans (Griseb.) B.R.Baum, J.L.Yang & C.Yen), while E. burchan-buddae (Nevski) Tzvelev (StY) exhibits the highest homology with the St and Y subgenomes of E. nutans (Xiong et al. 2025). The analysis results based on the chloroplast genome also indicate that the maternal donor of Campeiostachys species is more likely to be the genus Roegneria (StY) (Sha et al. 2025). Overall, we are more inclined to assume that Campeiostachys originated by natural hybridization involving Triticeae species with both StY and H genomes.

 The maternal donor of <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part></tp:taxon-name>

The cpDNA is maternally inherited in grasses (Middleton et al. 2014; Lei et al. 2018; Wang et al. 2019). Most studies suggest that Pseudoroegneria (St) serves as the maternal donor of most species containing the St subgenome in Triticeae (Mason-Gamer et al. 2002; McMillan and Sun 2004; Sha et al. 2010; Luo et al. 2012; Chen et al. 2021). This may occur from the increased success of hybridization when the species containing the St subgenome acts as the maternal parent, especially in intergeneric hybridization scenarios (Redinbaugh et al. 2000). However, some studies have shown that species with StY and P genomes both contributed to the origin of the species with StYP as maternal donors (Luo et al. 2012; Chen et al. 2021). Based on phylogenetic analyses of the chloroplast sequences ndhF and trnH-psbA, Lei et al. (2018) suggested that Pseudoroegneria (St) or Roegneria (StY) might be the maternal donors of the five Campeiostachys species. In the present study, the results of phylogenetic analyses based on matK and rps16 sequences revealed that the 15 Campeiostachys species formed a clade with the species containing St subgenome (whether diploid or polyploid) and diploids with V, E genome, but not with Hordeum (the H diploid donor) (Fig. 2). Nuclear gene data confirmed that the species of Campeiostachys do not contain E and V genomes, also supported by cytological results (Yen and Yang 2013; Yang et al. 2017; Tan et al. 2021, 2022, 2024). Therefore, the maternal donor of Campeiostachys species contains the St subgenome.

Based on the analysis of the single-copy nuclear gene and cpDNA sequences (Figs 1–4), we propose that Campeiostachys may have originated from a natural cross between a tetraploid species of Roegneria (StY) as the maternal donor and a diploid species of Hordeum (H) as the paternal donor.

 Phylogenetic relationships of some species in <italic><tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part></tp:taxon-name></italic> <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="purpuraristata">purpuraristata</tp:taxon-name-part></tp:taxon-name> and the <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">C.</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="dahurica">dahurica</tp:taxon-name-part></tp:taxon-name> complex

Elymus purpuraristatus (= Campeiostachys purpuraristata) is a perennial grass, mainly distributed in Inner Mongolia (Kuo 1987). Based on its morphological characteristics, it was classified into the genus Elymus (Kuo 1987; Yen and Yang 2013). Subsequently, the results of genomic in situ hybridization and phylogenetic analyses confirmed its genome composition as StYH, leading to its taxonomic revision to C. purpuraristata (Tan et al. 2021). Morphologically, C. purpuraristata is similar to the species of the C. dahurica complex, for example, the leaves are curled inward, the spikes erect or slightly curved, and spikelets densely arranged (Kuo 1987; Agafonov et al. 2001; Yen and Yang 2013). Cytogenetic analyses revealed that the average c-value of the hexaploid hybrid E. purpuraristatus × C. dahurica var. tangutorum (StYH) was 0.79 with an average of 19.11 bivalents, and the percentage of stained pollen grains and seed set of the hybrids was 86.00% and 62.69%, respectively (Tan et al. 2021). In the present study, it is noteworthy that C. purpuraristata is always grouped with the species of the C. dahurica complex in the St, Y, or H clade, as observed from both Acc1 and DMC1 sequence data (Figs 1, 2). Based on our molecular analyses in conjunction with previous studies (Yen and Yang 2013; Tan et al. 2021), we propose that the relationship between C. purpuraristata and C. dahurica var. tangutorum is infraspecific rather than interspecific. Consequently, it would be more appropriate to classify C. purpuraristata as a member of the C. dahurica complex. Thus, we suggest that C. purpuraristata should be reclassified.

 Plantae Poales Poaceae 4F5F619C-0DB6-5135-8DCA-83ECCBB69DAA Campeiostachys dahurica var. purpuraristata urn:lsid:ipni.org:names:77368636-1 (C.P.Wang & X.L.Yang) Y.H.Zhou, H.Q.Zhang, W.H.Chen & L.Tan stat. nov. Elymus purpuraristatus C.P.Wang & H.L.Yang, Bulletin of Botanical Research Harbin 4(4): 83. 1984. (Yang and Wang 1984) Campeiostachys purpuraristata (C.P.Wang & X.L.Yang) Y.H.Zhou, H.Q.Zhang & Wei Huan Chen (Tan et al. 2021: 252) Type

CHINA • Inner Mongolia, Daqing Mountains; 6 Aug. 1965; C.P. Wang 278; holotype: NMAC!.

 <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="calcicola">calcicola</tp:taxon-name-part></tp:taxon-name> and <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">C.</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="kamoji">kamoji</tp:taxon-name-part></tp:taxon-name>

Roegneria calcicola Keng (= Campeiostachys calcicola) and Roegneria kamoji (Ohwi) Ohwi ex Keng (= C. kamoji) are perennial herbs within Triticeae (Kuo 1987). In the present study, phylogenetic analyses demonstrated that Campeiostachys calcicola is closely related to C. kamoji (Figs 1–4). The distribution of C. calcicola and C. kamoji overlaps: C. kamoji is mainly distributed across most parts of China and the Korean Peninsula, while C. calcicola is restricted to calcareous hillside meadows and riversides in Southwest China (Kuo 1987). Morphologically, C. calcicola closely resembles C. kamoji: the leaf blade flat, the leaf sheaths glabrous, each rachis node bearing a single green or greyish green spikelet, and the spikelets are sparse. The biggest difference between the two species is that in C. calcicola the palea is longer than the lemma, whereas the palea is shorter than the lemma in C. kamoji (Kuo 1987; Yen and Yang 2013). However, the hybrids of C. calcicola × C. kamoji exhibited a low percentage of stained pollen grains and seed set (Tan et al. 2021), indicating significant reproductive isolation between them. In conclusion, based on molecular and morphological results, we assert that C. calcicola and C. kamoji are distinct yet closely related species.

 <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">Campeiostachys</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="kamoji">kamoji</tp:taxon-name-part></tp:taxon-name> and <tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Campeiostachys">C.</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="species" reg="tsukushiensis">tsukushiensis</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="infraspecific-rank">var.</tp:taxon-name-part> <tp:taxon-name-part taxon-name-part-type="variety" reg="transiens">transiens</tp:taxon-name-part></tp:taxon-name>

Lu et al. (1990) compared the morphological characteristics of Roegneria kamoji (= Campeiostachys kamoji) from China and Agropyron semicostatum var. transiens Hack. (= C. tsukushiensis var. transiens) from Japan, as well as the chromosome pairing of their hybrids. They suggested that the genomes of both species had high homology and should belong to the same taxonomic taxon. Thus, they were combined and named Roegneria tsukushiensis (Hack.) B.Rong Lu, Yen & J.L.Yang and R. tsukushiensis var. transiens (Hack.) B.Rong Lu, Yen & J.L.Yang, respectively. Then, according to the morphological characteristics and genome composition, the species were revised as Campeiostachys kamoji and C. tsukushiensis var. transiens, respectively (Baum et al. 2011; Yen and Yang 2013). In terms of distribution, there is no overlap in their geographical distribution, as Campeiostachys kamoji is mainly distributed in China (except Xinjiang, Tibet, and Qinghai) and the Korean Peninsula, while C. tsukushiensis var. transiens is mainly distributed in Japan (Baum et al. 2011; Yen and Yang 2013). In addition, there are a few morphological differences between Campeiostachys tsukushiensis var. transiens and C. kamoji. Compared to Campeiostachys kamoji, C. tsukushiensis var. transiens is a taller plant, and has longer spikes and longer lemma awn (Lu et al. 1990; Yen and Yang 2013). Also, there is only one spikelet on each rachis node in Campeiostachys kamoji, while there are 2–3 spikelets on each node in C. tsukushiensis var. transiens (Baum et al. 2011; Yen and Yang 2013). The spikelet number at each node is one of the important morphological indicators for classifying species in the Triticeae. In this study, the analysis results of Acc1 and DMC1 sequences showed that Campeiostachys kamoji was closely related to C. tsukushiensis var. transiens (Figs 1, 2). The F1 hybrids of Campeiostachys kamoji and C. tsukushiensis var. transiens exhibit a high frequency of bivalents (17–21) during meiosis metaphase I. However, the lower pollen staining rate and setting rate of their F1 hybrid indicates that these two species share the same chromosome composition, although their reproductive isolation degree is high (Lu et al. 1990). Based on the results of cytogenetic and molecular analyses, combined with morphological characteristics and geographical distribution, we conclude that Campeiostachys kamoji and C. tsukushiensis var. transiens represent distinct taxa.

 Conclusion

Campeiostachys species originated from natural hybridization between the tetraploid species of Roegneria (StY) and the diploid species of Hordeum (H), with Roegneria (StY) acting as the maternal donor. Campeiostachys purpuraristata should be classified into the Campeiostachys dahurica complex and treated as Campeiostachys dahurica var. purpuraristata (C.P.Wang & H.L.Yang) Y.H.Zhou, H.Q.Zhang, W.H.Chen & L.Tan.

 Acknowledgements

We would like to express our appreciation to Xiaoxia Zhu, Yang Song, and Qingxiang Huang for their management of the experimental plants. This project was supported by the National Natural Science Foundation of China (No. 32200180), the Science and Technology Bureau of Sichuan Province (2023NSFSC1995).

 References AdderleySSunGL (2014) Molecular evolution and nucleotide diversity of nuclear plastid phosphoglycerate kinase (PGK) gene in Triticeae (Poaceae).Gene533: 142–148. https://doi.org/10.1016/j.gene.2013.09.103 AgafonovAVBaumBRBaileyLGAgafonovaOV (2001) Differentiation in the Elymus dahuricus complex (Poaceae): evidence from grain proteins, DNA, and crossability.Hereditas135(2–3): 277–89. https://doi.org/10.1111/j.1601-5223.2001.00277.x BarkworthMEJacobsSWLZhangHQ (2009) Connorochloa: a new genus in Triticeae (Poaceae).Breeding Science59: 685–686. https://doi.org/10.1270/jsbbs.59.685 BaumBRYangJLYenCAgafonovAV (2011) A taxonomic synopsis of the genus Campeiostachys Drobov.Journal of Systematics and Evolution49: 146–159. https://doi.org/10.1111/j.1759-6831.2010.00106.x BaumBREdwardsTJohnsonDA (2015) Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S DNA variation in species with St and H haplomes.Molecular Genetics and Genomics290: 329–342. https://doi.org/10.1007/s00438-014-0907-4 BieniekWMiziantyMSzklarczykM (2015) Sequence variation at the three chloroplast loci (matK, rbcL, trnH-psbA) in the Triticeae tribe (Poaceae): comments on the relationships and utility in DNA barcoding of selected species.Plant Systematics and Evolution301(4): 1275–1286. https://doi.org/10.1007/s00606-014-1138-1 BlattnerFR (2009) Progress in phylogenetic analysis and a new infrageneric classification of the barley genus Hordeum (Poaceae: Triticeae).Breeding Science59: 471–480. https://doi.org/10.1270/jsbbs.59.471 BoratynGMSchäfferAAAgarwalaRAltschulSFLipmanDJMaddenTL (2012) Domain enhanced lookup time accelerated BLAST. Biology Direct 7: 12. https://doi.org/10.1186/1745-6150-7-12 BrassacJBlattnerFR (2015) Species-level phylogeny and polyploid relationships in Hordeum (Poaceae) inferred by next-generation sequencing and in silico cloning of multiple nuclear loci.Systematic Biology64(5): 792–808. https://doi.org/10.1093/sysbio/syv035 CaiLB (1997) A taxonomical study on the genus Roegneria C. Koch from China.Acta Phytotaxonomica Sinica35: 148–177. ChenSLZhuGH (2006) Tribe Triticeae. In: Flora of China, vol. 22 (Poaceae). Science Press, Beijing and Missouri Botanical Garden Press, St. Louis, 386–444. ChenSYYanHShaLNChenNZhangHQZhouYHFanX (2021) Chloroplast phylogenomic analyses resolve multiple origins of the Kengyilia species (Poaceae: Triticeae) via independent polyploidization events. Frontiers in Plant Science 12: 682040. https://doi.org/10.3389/fpls.2021.682040 DeweyDR (1984) The genome system of classification as a guide to intergeneric hybridization with the perennial Triticeae. In: GustafsonJP (Ed.) Gene Manipulation in Plant Improvement.Plenum Press, New York, 209–279. DongZ-ZFanXShaL-NWangYZengJKangH-YZhangH-QWangX-LZhangLDingC-BYangR-WZhouY-H (2015) Phylogeny and differentiation of the St genome in Elymus L. sensu lato (Triticeae; Poaceae) based on one nuclear DNA and two chloroplast genes. BMC Plant Biology 15: 179. https://doi.org/10.1186/s12870-015-0517-2 DoyleJJDoyleJL (1990) Isolation of plant DNA from fresh tissue.Focus12: 13–15. DrobowVP (1941) Campeiostachys. In: SchrederRRKudryashevSN (Ed.) Flora Uzbekistanica, vol 1.Uzbek Department of the Academy of Sciences of the USSR, Tashkent, 300–302. EdlerDKleinJAntonelliASilvestroD (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML.Methods in Ecology and Evolution12: 373–377. https://doi.org/10.1111/2041-210X.13512 FanXShaL-NDongZ-ZZhangH-QKangH-YWangYWangX-LZhangLDingC-BYangR-WZhengY-LZhouY-H (2013) Phylogenetic relationships and Y genome origin in Elymus sensu lato (Triticeae; Poaceae) based on single-copy nuclear Acc1 and Pgk1 gene sequences.Molecular Phylogenetics and Evolution69: 919–928. https://doi.org/10.1016/j.ympev.2013.06.012 FortunePMSchierenbeckKAAinoucheAKJacqueminJWendelJFAinoucheML (2007) Evolutionary dynamics of Waxy and the origin of hexaploid Spartina species (Poaceae).Molecular Phylogenetics and Evolution43(3): 1040–1055. https://doi.org/10.1016/j.ympev.2006.11.018 GaoGGouXMWangQZhangYDengJBDingCBZhangLZhouYHYangRW (2014) Phylogenetic relationships and Y genome origin in Chinese Elymus (Triticeae: Poaceae) based on single copy gene DMC1.Biochemical Systematics and Ecology57: 420–426. https://doi.org/10.1016/j.bse.2014.09.019 GrantV (1981) Plant Speciation. Second edition. Columbia University Press, New York, 1–563. GuindonSDelsucFDufayardJ-FGascuelO (2009) Estimating maximum likelihood phylogenies with PhyML. In: PosadaD (Ed.) Bioinformatics for DNA Sequence Analysis: Methods in Molecular Biology, vol.537. Humana Press, Totowa, NJ, 113–137. https://doi.org/10.1007/978-1-59745-251-9_6 Heslop-HarrisonJS (1992) Molecular cytogenetics, cytology and genomic comparisons in the Triticeae.Hereditas116: 93–99. https://doi.org/10.1111/j.1601-5223.1992.tb00210.x HodgeCDWangHSunG (2010) Phylogenetic analysis of the maternal genome of tetraploid StStYY Elymus (Triticeae: Poaceae) species and the monogenomic Triticeae based on rps16 sequence data.Plant Science178(5): 463–468. https://doi.org/10.1016/j.plantsci.2010.03.002 HuelsenbeckJPRonquistF (2001) MrBayes: Bayesian inference of phylogenetic trees.Bioinformatics17: 754–755. https://doi.org/10.1093/bioinformatics/17.8.754 JensenKB (1990) Cytology, fertility, and morphology of Elymus kengii (Keng) Tzvelev and E. grandiglumis (Keng) Á. Löve (Triticeae: Poaceae).Genome33: 563–570. https://doi.org/10.1139/g90-083 KatohKMisawaKKumaKMiyataT (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform.Nucleic Acids Research30(14): 3059–3066. https://doi.org/10.1093/nar/gkf436 KelloggEAAppelsRMason-GamerRJ (1996) When genes tell different stories: the diploid genera of Triticeae (Gramineae).Systematic Botany21: 321–347. https://doi.org/10.2307/2419662 KimberGAlonsoLC (1981) The analysis of meiosis in hybrids. III. Tetraploid hybrids.Canadian Journal of Genetics and Cytology23: 235–254. https://doi.org/10.1139/g81-026 KuoPC (1987) Flora Reipublicae Popularis Sinicae, vol.9(3).Science Press, Beijing,1-352. LeiYXLiuJFanXShaLNWangYKangHYZhouYHZhangHQ (2018) Phylogeny and maternal donor of Roegneria and its affinitive genera (Poaceae: Triticeae) based on sequence data for two chloroplast DNA regions (ndhF and trnH-psbA).Journal of Systematics and Evolution56(2): 105–119. https://doi.org/10.1111/jse.12291 LeiYXFanXShaLNWangYKangHYZhouYHZhangHQ (2022) Phylogenetic relationships and the maternal donor of Roegneria (Triticeae: Poaceae) based on three nuclear DNA sequences (ITS, Acc1, and Pgk1) and one chloroplast region (trnL‐F).Journal of Systematics and Evolution60(5): 1–14. https://doi.org/10.1111/jse.12664 LiuQLGeSTangHBZhangXLZhuGFLuBR (2006) Phylogenetic relationships in Elymus (Poaceae: Triticeae) based on the nuclear ribosomal internal transcribed spacer and chloroplast trnL-F sequences.New Phytologist170: 411–420. https://doi.org/10.1111/j.1469-8137.2006.01665.x LöveÁ (1982) Generic evolution of the wheatgrasses.Biologisches Zentralblatt101: 199–212. LöveÁ (1984) Conspectus of the Triticeae.Feddes Repertorium95: 425–521. https://doi.org/10.1002/j.1522-239X.1984.tb00022.x LuB-R (1993) Meiotic studies of Elymus nutans and E. jacquemontii (Poaceae, Triticeae) and their hybrids with Pseudoroegneria spicata and seventeen Elymus species.Plant Systematics and Evolution186(3-4): 193–212. https://doi.org/10.1007/BF00940798 LuBRYenCYangJL (1990) Cytological and morphologic studies of Agropyron tsukushiense var. transiens of Japan, Roegneria kamoji of China and their artificial hybrids.Acta BotanicaYunnanica13(3): 237–246. LucíaVRicoEAnamthawat-JónssonKMartínez-OrtegaMM (2019) Cytogenetic evidence for a new genus of Triticeae (Poaceae) endemic to the Iberian Peninsula: description and comparison with related genera.Botanical Journal of the Linnean Society4: 523–546. https://doi.org/10.1093/botlinnean/boz068 LuoXMTinkerNAXingFZhangHQShaLNKangHYDingCBLiuJZhangLYangRWZhouYH (2012) Phylogeny and maternal donor of Kengyilia species (Poaceae: Triticeae) based on three cpDNA (matK, rbcL and trnH-psbA) sequences.Biochemical Systematics & Ecology44: 61–69. https://doi.org/10.1016/j.bse.2012.04.004 Mason-GamerRJ (2004) Reticulate evolution, introgression, and intertribal gene capture in an allohexaploid grass.Systematic Biology53(1): 25–37. https://doi.org/10.1080/10635150490424402 Mason-GamerRJOrmeNLAndersonCM (2002) Phylogenetic analysis of North American Elymus and the monogenomic Triticeae (Poaceae) using three chloroplast DNA data sets.Genome45: 991–1002. https://doi.org/10.1139/g02-065 McMillanESunGL (2004) Genetic relationships of tetraploid Elymus species and their genomic donor species inferred from polymerase chain reaction-restriction length polymorphism analysis of chloroplast gene regions.Theoretical and Applied Genetics108: 535–542. https://doi.org/10.1007/s00122-003-1453-3 MiddletonCPSenerchiaNSteinNAkhunovEDKellerBWickerTKilianB (2014) Sequencing of chloroplast genomes from wheat, barley, rye and their relatives provides a detailed insight into the evolution of the Triticeae tribe. PLoS ONE 9: e85761. https://doi.org/10.1371/journal.pone.0085761 OttoSPWhittonJ (2000) Polyploid incidence and evolution.Annual Review of Genetics34: 401–437. https://doi.org/10.1146/annurev.genet.34.1.401 PetersenGSebergOYdeMBerthelsenK (2006) Phylogenetic relationships of Triticum and Aegilops and evidence for the origin of the A, B and D genomes of common wheat (Triticum aestivum).Molecular Phylogenetics and Evolution39: 70–82. https://doi.org/10.1016/j.ympev.2006.01.023 PetersenGSebergOSalomonB (2011) The origin of the H, St, W, and Y genomes in allotetraploid species of Elymus L. and Stenostachys Turcz. (Poaceae: Triticeae).Plant Systematics and Evolution291(3): 197–210. https://doi.org/10.1007/s00606-010-0381-3 PosadaDCrandallKA (1998) Modeltest: testing the model of DNA substitution.Bioinformatics14: 817–818. https://doi.org/10.1093/bioinformatics/14.9.817 RauscherJTDoyleJJBrownAH (2004) Multiple origins and nrDNA internal transcribed spacer homoeologue evolution in the Glycine tomentella (Leguminosae) allopolyploid complex.Genetics166: 987–998. RedinbaughMGJonesTAZhangY (2000) Ubiquity of the St chloroplast genome in St-containing Triticeae polyploids.Genome43: 846–852. https://doi.org/10.1139/g00-053 SearsER (1954) The aneuploids of common wheat.Research Bulletin of the Missouri Agricultural Experiment Station572: 1–59. ShaLNFanXYangRWKangHYDingCBZhangLZhengYLZhouYH (2010) Phylogenetic relationships between Hystrix and its closely related genera (Triticeae; Poaceae) based on nuclear Acc1, DMC1 and chloroplast trnL-F sequences.Molecular Phylogenetics and Evolution54(2): 327–335. https://doi.org/10.1016/j.ympev.2009.05.005 ShaLNFanXWangXLDongZZZengJZhangHQKangHYWangYLiaoJQZhouYH (2017) Genome origin, historical hybridization and genetic differentiation in Anthosachne australasica (Triticeae; Poaceae), inferred from chloroplast rbcL, trnH-psbA and nuclear Acc1 gene sequences.Annals of Botany119: 95–107. https://doi.org/10.1093/aob/mcw222 ShaLNChenNChenSYZhangYChengYRWuDDWangYKangHYZhangHQMaXZhouYHFanX (2025) Rapid diversification of St-genome-sharing species in wheat grasses (Triticeae: Poaceae) accompanied by diversifying selection of chloroplast genes. BMC Plant Biology 25: 32. https://doi.org/10.1186/s12870-025-06051-6 SoltisPSSoltisDE (2000) The role of genetic and genomic attributes in the success of polyploids.Proceedings of the National Academy of Sciences, USA97: 7051–7057. https://doi.org/10.1073/pnas.97.13.7051 SoltisDESoltisPSTateJA (2004) Advances in the study of polyploidy since plant speciation.New Phytologist161: 173–191. https://doi.org/10.1046/j.1469-8137.2003.00948.x StebbinsGL (1947) Types of polyploids: their classification and significance.Advances in Genetics1: 403–429. https://doi.org/10.1016/S0065-2660(08)60490-3 StebbinsGL (1950) Variation and Evolution in Plants. Columbia University Press, New York, 1–644. https://doi.org/10.7312/steb94536 SunGLNiYDaleyT (2008) Molecular phylogeny of RPB2 gene reveals multiple origin, geographic differentiation of H genome, and the relationship of the Y genome to other genomes in Elymus species.Molecular Phylogenetics and Evolution46: 897–907. https://doi.org/10.1016/j.ympev.2007.12.024 SunGLKomatsudaT (2010) Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.Molecular Phylogenetics and Evolution56: 727–733. https://doi.org/10.1016/j.ympev.2010.03.037 TanLZhangHQChenWHDengMQShaLNFanXKangHYWangYWuDDZhouYH (2021) Genome composition and taxonomic revision of Elymus purpuraristatus and Roegneria calcicola (Poaceae: Triticeae) based on cytogenetic and phylogenetic analyses.Botanical Journal of the Linnean Society196(2): 242–255. https://doi.org/10.1093/botlinnean/boaa103 TanLHuangQXSongYWuDDChengYRZhangCBShaLNFanXKangHYWangYZhangHQZhouYH (2022) Biosystematics studies on Elymus breviaristatus and Elymus sinosubmuticus (Poaceae: Triticeae). BMC Plant Biology 22: 57. https://doi.org/10.1186/s12870-022-03441-y TanLWuDDZhangCBChengYRShaLNFanXKangHYWangYZhangHQZhouYH (2024) Genome constitution and evolution of Elymus atratus (Poaceae: Triticeae) inferred from cytogenetic and phylogenetic analysis.Genes & Genomics46(5): 589–599. https://doi.org/10.1007/s13258-024-01496-9 TangCQiJChenNShaLNWangYZengJKangHYZhangHQZhouYHFanX (2017) Genome origin and phylogenetic relationships of Elymus villosus (Triticeae: Poaceae) based on single-copy nuclear Acc1, Pgk1, DMC1 and chloroplast trnL-F sequences.Biochemical Systematics and Ecology70: 168–176. https://doi.org/10.1016/j.bse.2016.11.011 TorabinejadJMuellerRJ (1993) Genome analysis of intergeneric hybrids of apomictic and sexual Australian Elymus species with wheat barley and rye: implication for the transfer of apomixis to cereals.Theoretical and Applied Genetics86(2): 288–294. https://doi.org/10.1007/bf00222090 WangLJiangYYShiQHWangYShaLNFanXKangHYZhangHQSunGLZhangLZhouYH (2019) Genome constitution and evolution of Elytrigia lolioides inferred from Acc1, EF-G, ITS, trnL-F sequences and GISH. BMC Plant Biology 19: 158. https://doi.org/10.1186/s12870-019-1779-x XiongYYuanSXiongYLLiLZYPengJHZhangJFanXShaLNWangZTPengXZhangZCYuQQLeiXDongZXLiuYJZhaoJMLiGRYangZJJiaSGLiDXSunMBaiSQLiuJQYangYZMaX (2025) Analysis of allohexaploid wheatgrass genome reveals its Y haplome origin in Triticeae and high-altitude adaptation. Nature Communications 16: 3104. https://doi.org/10.1038/s41467-025-58341-0 YangCRZhangHQZhaoFQLiuXYFanXShaNLKangHYWangYZhouYH (2015) Genome constitution of Elymus tangutorum (Poaceae: Triticeae) inferred from meiotic pairing behavior and genomic in situ hybridization.Journal of Systematics and Evolution53: 529–534. https://doi.org/10.1111/jse.12155 YangCRBaumBRChenWHZhangHQLiuXYFanXShaNLKangHYWangYZhouYH (2016) Genomic constitution and taxonomy of the Chinese hexaploids Elymus cylindricus and E. breviaristatus (Poaceae: Triticeae).Botanical Journal of the Linnean Society182: 650–657. https://doi.org/10.1111/boj.12469 YangCRZhangHQChenWHKangHYWangYShaLNFanXZengJZhouYH (2017) Genomic constitution and intergenomic translocations in the Elymus dahuricus complex revealed by multicolor GISH.Genome60(6): 510–517. https://doi.org/10.1139/gen-2016-0199 YangXWangC (1984) New taxa of Gramineae in China.Bulletin of Botanical Research Harbin4(4): 83–95. YenCYangJL (1990) Kengyilia gobicola, a new taxon from west China.Canadian Journal of Botany68: 1894–1897. https://doi.org/10.1139/b90-248 YenCYangJL (2011) Biosystematics of Triticeae, vol 3. China Agricultural Press, Beijing, 1–305. YenCYangJL (2013) Biosystematics of Triticeae, vol 5. China Agricultural Press, Beijing, 1–712. YenCYangJLBaumBR (2005) Douglasdeweya: a new genus, with a new species and a new combination (Triticeae: Poaceae).Canadian Journal of Botany83: 413–419. https://doi.org/10.1139/b05-018 ZhangDGaoFLJakovlićIZouHZhangJLiWXWangGT (2020) PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies.Molecular Ecology Resources20(1): 348–355. https://doi.org/10.1111/1755-0998.13096 ZhangHQZhouYH (2007) Meiotic analysis of the interspecific and intergeneric hybrids between Hystrix patula Moench and H. duthiei ssp. longearistata, Pseudoroegneria, Elymus, Roegneria, and Psathyrostachys species (Poaceae, Triticeae).Botanical Journal of the Linnean Society153: 213–219. https://doi.org/10.1111/j.1095-8339.2006.00600.x Supplementary materials 10.5091/plecevo.153974.suppl1 61673238-9125-5963-B05A-9B58016FA5FD

The Acc1 sequences used in the phylogenetic analyses.

 https://binary.pensoft.net/file/1412081 10.5091/plecevo.153974.suppl2 AA28A103-F14A-526B-80F4-3AC53B71680E

The DMC1 sequences used in the phylogenetic analyses.

 https://binary.pensoft.net/file/1412082 10.5091/plecevo.153974.suppl3 0E29120D-B89D-5B57-8AD8-A5C903326516

The matK and rps16 sequences used in the phylogenetic analyses.

 https://binary.pensoft.net/file/1412083